European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-TAX-ZM-003;  
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of maize invertase gene (ISO/FDIS 21569:2005).
Keywords taxon_specific, validated_independently.
From Zea mays (maize)
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods" ISO 21569:1-69 (2005)
ISO 34614
Reference Position 1-225
2 "Detection of a genetic modification of maize (Zea mays L.) by amplification of the modified DNA sequence by means of the polymerase chain reaction (PCR) and hybridization of the PCR product with a DNA probe or restriction analysis of the PCR product, N. L 15.05-1" Online Publication (2002)
Reference Position 1-225
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-TAX-ZM-003.pdf
Reference Position 1-225
Cross-references
GMOMETHODS QL-CON-00-003;
QL-CON-00-004;
QL-EVE-ZM-001;
QL-CON-00-005;
Features
Key Location Qualifier Value
STS 1..225 standard_namePCR 225 bp amplicon
noteTaxon-specific PCR for maize
targetinvertase (Ivr1) gene
primer_b 1..25 standard_namePrimer forward: IVR1-F
noteCCGCTGTATCACAAGGGCTGGTACC
targetIvr1
primer_b complement(201..225) standard_namePrimer reverse: IVR1-R
noteGGAGCCCGTGTAGAGCATGACGATC
targetIvr1
Sequence information
Length: 225 BP, A Count: 34, C Count: 88, T Count: 38, G Count: 65
ccgctgtatc acaagggctg gtaccnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
nnnnnnnnnn nnnnnnnnnn gatcgtcatg ctctacacgg gctcc                       225