European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-TAX-OS-002;  
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of rice Phospholipase D alpha 2 gene (Mazzara et al., 2006).
Keywords taxon_specific, validated_in_combination.
From Oryza sativa (rice)
References
1 Mazzara M., Cordeil S., Van Den Eede G.; "Report on the Verification of an Event-specific Detection Method for Identification of Rice GM-event LLRICE601 Using a Real-time PCR Assay" Online Publication (2006)
EURL_GMFF Verification Report LLRice601 event.pdf
Reference Position 1-68
2 "See Cross-references below" Online Publication (2010)
Reference Position 1-68
Cross-references
GMOMETHODS QL-EVE-OS-001;
Features
Key Location Qualifier Value
STS 1..68 standard_namePCR 68 bp amplicon
notetaxon-specific RT-PCR
targetphospholipase D (PLD) gene
primer_b 1..20 standard_namePrimer forward: KVM159
noteTGGTGAGCGTTTTGCAGTCT
targetPLD
primer_b 22..44 standard_nameRT-PCR probe: TM013
noteVIC-TGTTGTGCTGCCAATGTGGCCTG-TAMRA
primer_b complement(47..68) standard_namePrimer reverse: KVM160
noteCTGATCCACTAGCAGGAGGTCC
targetPLD
Sequence information
Length: 68 BP, A Count: 8, C Count: 14, T Count: 21, G Count: 22
tggtgagcgt tttgcagtct ntgttgtgct gccaatgtgg cctgnnggac ctcctgctag        60
tggatcag                                                                 68