An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-TAX-GM-008; SV 0; linear; genomic DNA; STS; PLN; 118 BP.
XX
AC   ;
XX
DT   23-JUN-2009
DT   05-OCT-2010
XX
DE   Qualitative PCR method for detection of soybean lectin gene
DE   (EU-Project SMT4-CT96-2072:1998).
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Glycine max (soybean)
XX
RN   [1]
RP   1-118
RT   "Developments of Methods to Identify Foods Produced by Means of Genetic Engineering Techniques (DMIF-GEN) - Final Report"
RL   EU-Project SMT4-CT96-2072:1-99 (1998).
XX
RN   [2]
RP   1-118
RT   "See Cross-references below";
RL   Online Publication (2010).
XX
DR   GMOMETHODS; QL-CON-00-006;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..118
FT                   /standard_name="PCR 118 bp amplicon"
FT                   /note="Taxon-specific PCR for soybean"
FT                   /target="lectin (Le1) gene"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: GM03"
FT                   /note="GCCCTCTACTCCACCCCCATCC"
FT                   /target="Le1"
FT   primer_bind     complement(96..118)
FT                   /standard_name="Primer reverse: GM04"
FT                   /note="GCCCATCTGCAAGCCTTTTTGTG"
FT                   /target="Le1"
XX
SQ   Sequence 118 BP; 27 A; 43 C; 22 G; 26 T; 0 other;
     gccctctact ccacccccat ccnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncacaa aaaggcttgc agatgggc         118
//