European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-TAX-GM-002;  
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of soybean lectin gene (ISO/FDIS 21569:2005).
Keywords taxon_specific, validated_independently.
From Glycine max (soybean)
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods" ISO 21569:1-69 (2005)
ISO 34614
Reference Position 1-118
2 "Detection of a genetic modification of soybeans by amplification of the modified DNA sequence by means of the polymerase chain reaction (PCR) and hybridization of the PCR product with a DNA probe, N. L23.01.22-1" Online Publication (1998)
Reference Position 1-118
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-TAX-GM-002.pdf
Reference Position 1-118
Cross-references
GMOMETHODS QL-CON-00-001;
Features
Key Location Qualifier Value
STS 1..118 standard_namePCR 118 bp amplicon
noteTaxon-specific PCR for soybean
targetlectin (Le1) gene
primer_b 1..22 standard_namePrimer forward: GM03
noteGCCCTCTACTCCACCCCCATCC
targetLe1
primer_b complement(96..118) standard_namePrimer reverse: GM04
noteGCCCATCTGCAAGCCTTTTTGTG
targetLe1
Sequence information
Length: 118 BP, A Count: 27, C Count: 43, T Count: 26, G Count: 22
gccctctact ccacccccat ccnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncacaa aaaggcttgc agatgggc         118