An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-EVE-ZM-002; SV 0; linear; genomic DNA; STS; SYN; 117 BP.
XX
AC   ;
XX
DT   15-DEC-2005
DT   13-DEC-2011
XX
DE   Qualitative PCR method for detection of maize event Bt10 (verified by the EU-RL GMFF in the context of Commission Decision 317/2005/EC)
XX
KW   event_specific, EU-RL_GMFF_in-house_verified.
XX
OS   Zea mays (maize) - event Bt10
XX
RN   [1]
RP   1-117
RA   Mazzara M., Foti N., Maretti M., Savini C., Van den Eede G.;
RT   "Report on the In-House Validation of an event-specific Detection Method
RT   for Event Bt10 using a qualitative PCR assay and verification by
RT   restriction analysis - Scientific Report - Version 2";
RL   Online Publication (2005).
RX   EURL_GMFF=Bt10 validation report version2.pdf
XX
RN   [2]
RP   1-117
RA   Van den Eede G.;
RT   "PCR Assay for Detection of Maize Transgenic Event Bt10 - Scientific
RT   Report - Version 2";
RL   Online Publication (2005).
RX   EURL_GMFF=Bt10 Detection Protocol version2.pdf
XX
RN   [3]
RP   1-117
RA   Van den Eede G.;
RT   "Molecular characterization of GM event Bt10. Summary report on
RT   scientific data obtained at the JRC-GMO-CRL and an analysis of the data
RT   on Bt10, obtained by Syngenta";
RL   Online Publication (2006).
RX   EURL_GMFF=Bt10_Executive summary.pdf
XX
RN   [4]
RP   1-117
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2011).
RX   PCR=QL-EVE-ZM-002.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..117
FT                   /standard_name="PCR 117 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="Not provided"
FT   primer_bind     1..29
FT                   /standard_name="Primer forward: JSF5"
FT                   /note="CACACAGGAGATTATTATAGGGTTACTCA"
FT                   /target="Not provided"
FT   primer_bind     complement(90..117)
FT                   /standard_name="Primer reverse: JSR5"
FT                   /note="ACACGGAAATGTTGAATACTCATACTCT"
FT                   /target="Not provided"
XX
SQ   Sequence 117 BP; 42 A; 20 C; 21 G; 34 T; 0 other;
     cacacaggag attattatag ggttactcan nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnna gagtatgagt attcaacatt tccgtgt          117
//