ID QL-ELE-00-020; SV 1; linear; other DNA; STD; UNA; 73 BP. XX AC ; XX DT 07-JAN-2010 DT 29-FEB-2016 XX DE Qualitative PCR method for detection of cry1A(b) gene (Barbau-Piednoir et al., 2014). XX KW element_specific. XX RN [1] RP 1-73 RA Barbau-Piednoir E., Stragier P., Roosens N., Mazzara M., Van den Eede G., RA Van den Bulcke M.; RT "Inter-laboratory Testing of GMO Detection by Combinatory SYBR Green PCR RT Screening(CoSYPS)"; RL Food Analitical Methods 0:0-0 (2014). RX DOI=10.1007/s12161-014-9837-3 XX RN [2] RP 1-73 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2014). RX PCR=QL-ELE-00-020.pdf XX DR GMOMETHODS; QL-TAX-BN-003; DR GMOMETHODS; QL-TAX-GM-001; DR GMOMETHODS; QL-TAX-ZM-002; DR GMOMETHODS; QL-PLN-00-006; XX FH Key Location/Qualifiers FH FT misc_feature 1..73 FT /note="Sybricon020 insert containing partial Bacillus FT thuringiensis Cry1A(b) gene isolated from Zea mays MON810" FT STS 1..73 FT /standard_name="PCR 73 bp amplicon" FT /note="element-specific PCR" FT /target="cry1A(b) synthetic construct derived from Bacillus thuringiensis" FT primer_bind 1..19 FT /standard_name="Primer reverse: Cry1Ab_Bt_Cott_Rev" FT /note="CAGCACCTGGCACGAACTC" FT /target="cry1A(b)" FT primer_bind complement(54..73) FT /standard_name="Primer forward: Cry1Ab_Bt_Cott_Fwd" FT /note="ACCGGTTACACTCCCATCGA" FT /target="cry1A(b)" XX SQ Sequence 73 BP; 18 A; 15 C; 29 G; 11 T; 0 other; cagcacctgg cacgaactcn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnntcgatgg 60 gagtgtaacc ggt 73 //