European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-007;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of nopaline synthase terminator (EU-Project SMT4-CT96-2072:1998).
Keywords element_specific.
1 "Developments of Methods to Identify Foods Produced by Means of Genetic Engineering Techniques (DMIF-GEN) - Final Report" EU-Project SMT4-CT96-2072:1-99 (1998)
Reference Position 1-180
2 "Screening procedure for the detection of genetically modified DNA sequences in foods by identification of DNA sequences that frequently occur in genetically modified organisms. No. L 00.00-31" Online Publication (1998)
Reference Position 1-180
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-ELE-00-007.pdf
Reference Position 1-180
Features
Key Location Qualifier Value
STS 1..180 standard_namePCR 180 bp amplicon
noteelement-specific PCR
targetnopaline synthase terminator (T-nos) from Agrobacterium tumefaciens
primer_b 1..20 standard_namePrimer forward: NOS-1
noteGAATCCTGTTGCCGGTCTTG
targetT-nos
primer_b complement(161..180) standard_namePrimer reverse: NOS-3
noteTTATCCTAGTTTGCGCGCTA
targetT-nos
Sequence information
Length: 180 BP, A Count: 10, C Count: 9, T Count: 10, G Count: 11
gaatcctgtt gccggtcttg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn tagcgcgcaa actaggataa       180