European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-011;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of the junction between the Cauliflower Mosaic Virus 35S promoter and the pat gene
Keywords construct_specific.
1 "Horizontal methods for molecular biomarker analysis ó Methods of analysis for the detection of genetically modified organisms and derived products ó Part 3: Construct-specific real-time PCR method for detection of P35S-pat-sequence for screening genetically modified organisms" ISO/TS 21569-3:2015 (2015)
ISO 63468
Reference Position 1-102
2 "Real-time PCR detection of the P35S-pat genetic construct to screen for genetically modified plants" BVL G 30.40-1:2012-07 (2012)
BVL bvl-g-3040-1/155757481
Reference Position 1-102
3 "PCR reactions set up and amplification conditions" Online Publication (2014)
PCR QL-CON-00-011.pdf
Reference Position 1-102
Features
Key Location Qualifier Value
STS 1..102 standard_namePCR 102-111 bp amplicon
noteconstruct-specific RT-PCR
targetJunction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the phosphinothricin N-acetyl transferase (pat) gene from Streptomyces viridochromogenes
primer_b 1..25 standard_namePrimer forward: 35SP03.f
noteAAGTTCATTTCATTTGGAGAGGACA
targetCaMV P-35S
primer_b 1..78 standard_nameRT-PCR probe: probe GSS01.s
noteFAM-CCGGAGAGGAGACCAGTTGAGATTAGGC-TAMRA
primer_b complement(82..102) standard_namePrimer reverse: pat-7.r
noteCGGCCATATCAGCTGCTGTAG
targetpat
Sequence information
Length: 102 BP, A Count: 26, C Count: 23, T Count: 21, G Count: 32
aagttcattt catttggaga ggacannnnn nnnnnnnnnn nnnnnnnnnn ccggagagga        60
gaccagttga gattaggcnn nctacagcag ctgatatggc cg                          102