An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-CON-00-011; SV 1; linear; genomic DNA; STD; SYN; 102 BP.
XX
AC   ;
XX
DT   20-DEC-2013
DT   29-FEB-2016
XX
DE   Qualitative PCR method for detection of the junction between the Cauliflower Mosaic Virus 35S promoter and the pat gene
XX
KW   construct_specific.
XX
RN   [1]
RP   1-102
RT   "Horizontal methods for molecular biomarker analysis --  Methods of analysis for the detection of genetically modified organisms and derived products - Part 3: Construct-specific real-time PCR method for detection of P35S-pat-sequence for screening genetically modified organisms";
RL   ISO/TS 21569-3:2015 (2015).
RX   ISO=63468  
XX
RN   [2]
RP   1-102
RT   "Real-time PCR detection of the P35S-pat genetic construct to screen for genetically modified plants";
RL   BVL G 30.40-1:2012-07 (2012).
RX   BVL=bvl-g-3040-1/155757481  
XX
RN   [3]
RP   1-102
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2014).
RX   PCR=QL-CON-00-011.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..102
FT                   /standard_name="PCR 102-111 bp amplicon"
FT                   /note="construct-specific RT-PCR"
FT                   /target="Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the phosphinothricin N-acetyl transferase (pat) gene from Streptomyces viridochromogenes"
FT   primer_bind     1..25
FT                   /standard_name="Primer forward: 35SP03.f"
FT                   /note="AAGTTCATTTCATTTGGAGAGGACA"
FT                   /target="CaMV P-35S"
FT   primer_bind    51..78
FT                   /standard_name="RT-PCR probe: probe GSS01.s"
FT                   /note="FAM-CCGGAGAGGAGACCAGTTGAGATTAGGC-TAMRA"
FT   primer_bind     complement(82..102)
FT                   /standard_name="Primer reverse: pat-7.r"
FT                   /note="CGGCCATATCAGCTGCTGTAG"
FT                   /target="pat"
XX
SQ   Sequence 102 BP; 26 A; 23 C; 32 G; 21 T; 0 other;
     aagttcattt catttggaga ggacannnnn nnnnnnnnnn nnnnnnnnnn ccggagagga        60
     gaccagttga gattaggcnn nctacagcag ctgatatggc cg                          102
//