European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


ID   QL-CON-00-010; SV 0; linear; genomic DNA; STS; SYN; 105 BP.
XX
AC   CDC-FL001-2;
XX
DT   27-NOV-2012
DT   01-DEC-2016
XX
DE   Qualitative PCR method for detection of flax event FP967
XX
KW   construct_specific.
XX
OS   Linum usitatissimum (flax) - event FP967 (CDC-FL001-2)
XX
RN   [1]
RP   1-105
RA   Grohmann L., Busch U., Pecoraro S., Hess N., Pietsch K., Mankertz J.;
RT   "Collaborative trial validation of a construct-specific real-time PCR
RT   method for detection of genetically modified linseed event 'CDC Triffid'
RT   FP967";
RL   Eur Food Res Technol 232:557-561 (2011).
RX   DOI=10.1007/s00217-010-1403-7
XX
RN   [2]
RP   1-105
RT   "Horizontal methods for molecular biomarker analysis - Methods of analysis for the detection of genetically modified organisms and derived products - Part 2: Construct-specific real-time PCR method for detection of event FP967 in linseed and linseed products";
RL   ISO/TS 21569-2:1-9 (2012).
RX   ISO=60166
XX
RN   [3]
RP   1-105
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Report on the Verification of the Performance of a Construct-Specific Assay for the Detection of Flax CDC Triffid Event FP967 Using Real-Time PCR";
RL   Online Publication (2009).
RX   CRL-DOC=Flax-CDCTriffidFlaxJRC091030.pdf
RX   CRL-DOC=Flax_FP967_verification_report.pdf
XX
RN   [4]
RP   1-105
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QL-CON-00-010.pdf
XX
DR   GMOMETHODS; QL-TAX-LU-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..105
FT                   /standard_name="PCR 105 bp amplicon"
FT                   /note="construct-specific RT-PCR"
FT                   /target="Junction region between the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens and the dihydrofolate reductase (dhfr) gene from Escherichia coli";
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: NOST-Spec FW"
FT                   /note="AGCGCGCAAACTAGGATAAA"
FT                   /target="T-nos"
FT   primer_bind     25..44
FT                   /standard_name="RT-PCR probe: NOST-Spec Probe"
FT                   /note="FAM-CGCGCGCGGTGTCATCTATG-BHQ"
FT   primer_bind     complement(86..105)
FT                   /standard_name="Primer reverse: NOST-Spec RV"
FT                   /note="ACCTTCCGGCTCGATGTCTA"
FT                   /target="dhfr"
XX
SQ   Sequence 105 BP; 35 A; 22 C; 23 G; 25 T; 0 other;
     agcgcgcaaa ctaggataaa nnnncgcgcg cggtgtcatc tatgnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnntagac atcgagccgg aaggt                       105
//