European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-010;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier CDC-FL001-2
Description
Description Qualitative PCR method for detection of flax event FP967
Keywords construct_specific.
From Linum usitatissimum (flax) - event FP967 (CDC-FL001-2)
References
1 Grohmann L., Busch U., Pecoraro S., Hess N., Pietsch K., Mankertz J.; "Collaborative trial validation of a construct-specific real-time PCR method for detection of genetically modified linseed event 'CDC Triffid' FP967" Eur Food Res Technol 232:557-561 (2011)
DOI 10.1007/s00217-010-1403-7
Reference Position 1-105
2 "Horizontal methods for molecular biomarker analysis - Methods of analysis for the detection of genetically modified organisms and derived products - Part 2: Construct-specific real-time PCR method for detection of event FP967 in linseed and linseed products" ISO/TS 21569-2:1-9 (2012)
ISO 60166
Reference Position 1-105
3 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Report on the Verification of the Performance of a Construct-Specific Assay for the Detection of Flax CDC Triffid Event FP967 Using Real-Time PCR" Online Publication (2009)
CRL-DOC Flax-CDCTriffidFlaxJRC091030.pdf
CRL-DOC Flax_FP967_verification_report.pdf
Reference Position 1-105
4 "PCR reactions set up and amplification conditions" Online Publication (2012)
PCR QL-CON-00-010.pdf
Reference Position 1-105
Cross-references
GMOMETHODS QL-TAX-LU-001;
Features
Key Location Qualifier Value
STS 1..105 standard_namePCR 105 bp amplicon
noteconstruct-specific RT-PCR
targetJunction region between the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens and the dihydrofolate reductase (dhfr) gene from Escherichia coli
primer_b 1..20 standard_namePrimer forward: NOST-Spec FW
noteAGCGCGCAAACTAGGATAAA
targetT-nos
primer_b 25..44 standard_nameRT-PCR probe: NOST-Spec Probe
noteFAM-CGCGCGCGGTGTCATCTATG-BHQ
primer_b complement(86..105) standard_namePrimer reverse: NOST-Spec RV
noteACCTTCCGGCTCGATGTCTA
targetdhfr
Sequence information
Length: 105 BP, A Count: 35, C Count: 22, T Count: 25, G Count: 23
agcgcgcaaa ctaggataaa nnnncgcgcg cggtgtcatc tatgnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnntagac atcgagccgg aaggt                       105