An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-CON-00-010; SV 0; linear; genomic DNA; STS; SYN; 105 BP.
XX
AC   CDC-FL001-2;
XX
DT   27-NOV-2012
DT   01-DEC-2016
XX
DE   Qualitative PCR method for detection of flax event FP967
XX
KW   construct_specific.
XX
OS   Linum usitatissimum (flax) - event FP967 (CDC-FL001-2)
XX
RN   [1]
RP   1-105
RA   Grohmann L., Busch U., Pecoraro S., Hess N., Pietsch K., Mankertz J.;
RT   "Collaborative trial validation of a construct-specific real-time PCR
RT   method for detection of genetically modified linseed event 'CDC Triffid'
RT   FP967";
RL   Eur Food Res Technol 232:557-561 (2011).
RX   DOI=10.1007/s00217-010-1403-7
XX
RN   [2]
RP   1-105
RT   "Horizontal methods for molecular biomarker analysis - Methods of analysis for the detection of genetically modified organisms and derived products - Part 2: Construct-specific real-time PCR method for detection of event FP967 in linseed and linseed products";
RL   ISO/TS 21569-2:1-9 (2012).
RX   ISO=60166
XX
RN   [3]
RP   1-105
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Report on the Verification of the Performance of a Construct-Specific Assay for the Detection of Flax CDC Triffid Event FP967 Using Real-Time PCR";
RL   Online Publication (2009).
RX   CRL-DOC=Flax-CDCTriffidFlaxJRC091030.pdf
RX   CRL-DOC=Flax_FP967_verification_report.pdf
XX
RN   [4]
RP   1-105
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QL-CON-00-010.pdf
XX
DR   GMOMETHODS; QL-TAX-LU-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..105
FT                   /standard_name="PCR 105 bp amplicon"
FT                   /note="construct-specific RT-PCR"
FT                   /target="Junction region between the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens and the dihydrofolate reductase (dhfr) gene from Escherichia coli";
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: NOST-Spec FW"
FT                   /note="AGCGCGCAAACTAGGATAAA"
FT                   /target="T-nos"
FT   primer_bind     25..44
FT                   /standard_name="RT-PCR probe: NOST-Spec Probe"
FT                   /note="FAM-CGCGCGCGGTGTCATCTATG-BHQ"
FT   primer_bind     complement(86..105)
FT                   /standard_name="Primer reverse: NOST-Spec RV"
FT                   /note="ACCTTCCGGCTCGATGTCTA"
FT                   /target="dhfr"
XX
SQ   Sequence 105 BP; 35 A; 22 C; 23 G; 25 T; 0 other;
     agcgcgcaaa ctaggataaa nnnncgcgcg cggtgtcatc tatgnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnntagac atcgagccgg aaggt                       105
//