European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


ID   QL-CON-00-007; SV 0; linear; genomic DNA; STS; SYN; 83 BP.
XX
AC   ;
XX
DT   04-AUG-2009
DT   05-OCT-2016
XX
DE   Qualitative PCR method for detection of the junction  between a cry1A(b)/cry1A(c) fusion gene and DNA spacer sequences (Grohmann and Maede, 2009).
XX
KW   construct_specific.
XX
OS   Oryza sativa (rice) - event Bt63
XX
RN   [1]
RP   1-83
RA   Grohmann L., Maede D.;
RT   "Detection of genetically modified rice: collaborative validation study
RT   of a construct-specific real-time PCR method for detection of transgenic
RT   Bt rice";
RL   Eur. Food Res. Technol. 228:497-500 (2009).
RX   DOI=10.1007/s00217-008-0964-1
XX
RN   [2]
RP   1-83
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-CON-00-007.pdf
XX
DR   GMOMETHODS; QL-TAX-OS-003;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..83
FT                   /standard_name="PCR 83 bp amplicon"
FT                   /note="construct-specific RT-PCR"
FT                   /target="Junction region between the cry1A(b)/cry1A(c) fusion gene and the DNA spacer sequences linking the fusion gene to the nopaline synthase terminator (T-nos)"
FT   primer_bind     1..25
FT                   /standard_name="Primer forward: T51F"
FT                   /note="GACTGCTGGAGTGATTATCGACAGA"
FT                   /target="cry1Ac"
FT   primer_bind     26..59
FT                   /standard_name="RT-PCR probe: T51p"
FT                   /note="FAM-TCGAGTTCATTCCAGTTACTGCAACACTCGAG-TAMRA"
FT   primer_bind     complement(60..83)
FT                   /standard_name="Primer reverse: T51R"
FT                   /note="AGCTCGGTACCTCGACTTATTCAG"
FT                   /target="DNA spacer sequences"
XX
SQ   Sequence 83 BP; 14 A; 9 C; 15 G; 11 T; 34 other;
     gactgctgga gtgattatcg acagannnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnc        60
     tgaataagtc gaggtaccga gct                                                83
//