Entry information |
Entry name | QL-CON-00-006; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
GMO Unique Identifier | MON-04032-6 |
Description |
Description | Qualitative PCR method for detection of the junction between the CaMV35S promoter and the chloroplast transit peptide sequence (EU-Project SMT4-CT96-2072:1998). |
Keywords | construct_specific. |
From | Glycine max (soybean) - event GTS-40-3-2 (MON-04032-6) |
References |
1 | "Developments of Methods to Identify Foods Produced by Means of Genetic Engineering Techniques (DMIF-GEN) - Final Report" EU-Project SMT4-CT96-2072:1-99 (1998) |
2 | "PCR reactions set up and amplification conditions" Online Publication (2010) |
Cross-references |
GMOMETHODS | QL-TAX-GM-008; |
Features |
Key | Location | Qualifier | Value | STS | 1..172 | standard_name | PCR 172 bp amplicon | note | Construct-specific PCR | target | Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chloroplast-transit-peptide (CTP) sequence from Petunia hybrida epsps gene | primer_b | 1..22 | standard_name | Primer forward: p35S-af2 | note | TGATGTGATATCTCCACTGACG | target | CaMV P-35S | primer_b | complement(151..172) | standard_name | Primer reverse: petu-ar1 | note | TGTATCCCTTGAGCCATGTTGT | target | CTP4 |
|
Sequence information |
Length: 172 BP, A Count: 14, C Count: 10, T Count: 10, G Count: 10 |
tgatgtgata tctccactga cgnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn acaacatggc tcaagggata ca 172
|