European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-005;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-ZM003-2
Description
Description Qualitative PCR method for detection of the junction between the pat gene and the CaMV35S terminator (ISO/FDIS 21569:2005).
Keywords construct_specific.
From Zea mays (maize) - event T25 (ACS-ZM003-2)
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods" ISO 21569:1-69 (2005)
ISO 34614
Reference Position 1-209
2 "Detection of a genetic modification of maize (Zea mays L.) by amplification of the modified DNA sequence by means of the polymerase chain reaction (PCR) and hybridization of the PCR product with a DNA probe or restriction analysis of the PCR product, N. L 15.05-1" Online Publication (2002)
Reference Position 1-209
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-CON-00-005.pdf
Reference Position 1-209
Cross-references
GMOMETHODS QL-TAX-ZM-003;
Features
Key Location Qualifier Value
STS 1..209 standard_namePCR 209 bp amplicon
noteConstruct-specific PCR
targetJunction region between the phosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes and the Cauliflower Mosaic Virus 35S terminator (CaMV T-35S)
primer_b 1..21 standard_namePrimer forward: T25-F7
noteATGGTGGATGGCATGATGTTG
targetpat
primer_b complement(187..209) standard_namePrimer reverse: T25-R3
noteTGAGCGAAACCCTATAAGAACCC
targetCaMV T-35S
Sequence information
Length: 209 BP, A Count: 7, C Count: 5, T Count: 16, G Count: 16
atggtggatg gcatgatgtt gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
nnnnnngggt tcttataggg tttcgctca                                         209