European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-004;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-EV176-9
Description
Description Qualitative PCR method for detection of the junction between the CDPK promoter from maize and the synthetic cry1A(b) gene (ISO/FDIS 21569:2005).
Keywords construct_specific.
From Zea mays (maize) - event Bt176 (SYN-EV176-9)
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods" ISO 21569:1-69 (2005)
ISO 34614
Reference Position 1-211
2 "Detection of a genetic modification of maize (Zea mays L.) by amplification of the modified DNA sequence by means of the polymerase chain reaction (PCR) and hybridization of the PCR product with a DNA probe or restriction analysis of the PCR product, N. L 15.05-1" Online Publication (2002)
Reference Position 1-211
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-CON-00-004.pdf
Reference Position 1-211
Cross-references
GMOMETHODS QL-TAX-ZM-003;
Features
Key Location Qualifier Value
STS 1..211 standard_namePCR 211 bp amplicon
noteConstruct-specific PCR
targetJunction region between the calcium-dependent protein kinase promoter (P-CDPK) from maize and the synthetic cry1A(b) gene
primer_b 1..20 standard_namePrimer forward: Cry03
noteCTCTCGCCGTTCATGTCCGT
targetP-CDPK
primer_b complement(192..211) standard_namePrimer reverse: Cry04
noteGGTCAGGCTCAGGCTGATGT
targetcry1A(b)
Sequence information
Length: 211 BP, A Count: 6, C Count: 16, T Count: 10, G Count: 8
ctctcgccgt tcatgtccgt nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
nnnnnnnnnn nacatcagcc tgagcctgac c                                      211