European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-003;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-BT011-1
Description
Description Qualitative PCR method for detection of the junction between the intron 2 from the maize adh1 gene and the pat gene(ISO/FDIS 21569:2005).
Keywords construct_specific.
From Zea mays (maize) - event Bt11 (SYN-BT011-1)
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods" ISO 21569:1-69 (2005)
ISO 34614
Reference Position 1-189
2 "Detection of a genetic modification of maize (Zea mays L.) by amplification of the modified DNA sequence by means of the polymerase chain reaction (PCR) and hybridization of the PCR product with a DNA probe or restriction analysis of the PCR product, N. L 15.05-1" Online Publication (2002)
Reference Position 1-189
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-CON-00-003.pdf
Reference Position 1-189
Cross-references
GMOMETHODS QL-TAX-ZM-003;
Features
Key Location Qualifier Value
STS 1..189 standard_namePCR 189 bp amplicon
noteConstruct-specific PCR
targetJunction region between the Intron 2 (IVS2) from the maize alcohol dehydrogenase 1 (adh1) gene and the phosphinothricin N-acetyltransferase (pat) gene
primer_b 1..22 standard_namePrimer forward: IVS2-2
noteCTGGGAGGCCAAGGTATCTAAT
targetIVS 2 adh1
primer_b complement(168..189) standard_namePrimer reverse: PAT-B
noteGCTGCTGTAGCTGGCCTAATCT
targetpat
Sequence information
Length: 189 BP, A Count: 40, C Count: 50, T Count: 49, G Count: 50
ctgggaggcc aaggtatcta atnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnaga ttaggccagc       180
tacagcagc                                                               189