European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-002;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of the junction between the polygalacturonase gene and the nos terminator(ISO/FDIS 21569:2005).
Keywords construct_specific.
From Solanum lycopersicum (tomato) - event Nema282F
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods" ISO 21569:1-69 (2005)
ISO 34614
Reference Position 1-350
2 "Detection of a genetic modification of tomatoes by amplification of the modified DNA sequence by means of the polymerase chain reaction (PCR) and hybridization of the PCR product with a DNA probe or restriction analysis of the PCR product, No. L25.03.01" Online Publication (1999)
Reference Position 1-350
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-CON-00-002.pdf
Reference Position 1-350
Cross-references
GMOMETHODS QL-TAX-SL-001;
Features
Key Location Qualifier Value
STS 1..350 standard_namePCR 350 bp amplicon
noteconstruct-specific PCR
targetJunction region between the polygalacturonase (PG) gene copy from Solanum lycopersicum L. and the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens
primer_b 1..21 standard_namePrimer forward: PG34L
noteGGATCCTTAGAAGCATCTAGT
targetPG
primer_b complement(331..350) standard_namePrimer reverse: t-Nos
noteCATCGCAAGACCGGCAACAG
targetT-nos
Sequence information
Length: 350 BP, A Count: 7, C Count: 9, T Count: 13, G Count: 12
ggatccttag aagcatctag tnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ctgttgccgg tcttgcgatg                  350