An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-CON-00-001; SV 0; linear; genomic DNA; STS; SYN; 172 BP.
XX
AC   MON-04032-6;
XX
DT   23-JUN-2009
DT   05-OCT-2016
XX
DE   Qualitative PCR  method for detection of the junction  between the CaMV35S promoter and the chloroplast transit peptide sequence (ISO/FDIS 21569:2005).
XX
KW   construct_specific.
XX
OS   Glycine max (soybean) - event GTS-40-3-2 (MON-04032-6)
XX
RN   [1]
RP   1-172
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Qualitative nucleic acid based
RT   methods";
RL   ISO 21569:1-69 (2005).
RX   ISO=34614
XX
RN   [2]
RP   1-172
RT   "Detection of a genetic modification of soybeans by amplification of the
RT   modified DNA sequence by means of the polymerase chain reaction (PCR) and
RT   hybridization of the PCR product with a DNA probe, N. L23.01.22-1";
RL   Online Publication (1998).
XX
RN   [3]
RP   1-172
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-CON-00-001.pdf
XX
DR   GMOMETHODS; QL-TAX-GM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..172
FT                   /standard_name="PCR 172 bp amplicon"
FT                   /note="Construct-specific PCR"
FT                   /target="Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chloroplast transit peptide (CTP) sequence from Petunia hybrida epsps gene"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: p35s-f2"
FT                   /note="TGATGTGATATCTCCACTGACG"
FT                   /target="CaMV P-35S"
FT   primer_bind     complement(151..172)
FT                   /standard_name="Primer reverse: petu-r1"
FT                   /note="TGTATCCCTTGAGCCATGTTGT"
FT                   /target="CTP4"
XX
SQ   Sequence 172 BP; 14 A; 10 C; 10 G; 10 T; 128 other;
     tgatgtgata tctccactga cgnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn acaacatggc tcaagggata ca               172
//