European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-04032-6
Description
Description Qualitative PCR method for detection of the junction between the CaMV35S promoter and the chloroplast transit peptide sequence (ISO/FDIS 21569:2005).
Keywords construct_specific.
From Glycine max (soybean) - event GTS-40-3-2 (MON-04032-6)
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods" ISO 21569:1-69 (2005)
ISO 34614
Reference Position 1-172
2 "Detection of a genetic modification of soybeans by amplification of the modified DNA sequence by means of the polymerase chain reaction (PCR) and hybridization of the PCR product with a DNA probe, N. L23.01.22-1" Online Publication (1998)
Reference Position 1-172
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-CON-00-001.pdf
Reference Position 1-172
Cross-references
GMOMETHODS QL-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..172 standard_namePCR 172 bp amplicon
noteConstruct-specific PCR
targetJunction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chloroplast transit peptide (CTP) sequence from Petunia hybrida epsps gene
primer_b 1..22 standard_namePrimer forward: p35s-f2
noteTGATGTGATATCTCCACTGACG
targetCaMV P-35S
primer_b complement(151..172) standard_namePrimer reverse: petu-r1
noteTGTATCCCTTGAGCCATGTTGT
targetCTP4
Sequence information
Length: 172 BP, A Count: 14, C Count: 10, T Count: 10, G Count: 10
tgatgtgata tctccactga cgnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn acaacatggc tcaagggata ca               172