European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-023;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-EV176-9
Description
Description Quantitative PCR method for detection of maize event Bt176 (verified by the EU-RL GMFF in the context of Commission Decision 2007/304/EC)
Keywords event_specific, EU-RL_GMFF_in-house_verified.
From Zea mays (maize) - event Bt176 (SYN-EV176-9)
References
1 Savini C., Mazzara M., Pinski G., Van den Eede G.; "In-house Validation of an Event-specific Method for the Quantification of Maize Bt176 Using Real-time PCR - Validation Report" Online Publication (2011)
DOI 10.2788/35536
EURL_GMFF Bt176_CRLVL1804_validated_Method.pdf
Reference Position 1-82
2 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QT-EVE-ZM-023.pdf
Reference Position 1-82
Cross-references
GMOMETHODS QT-TAX-ZM-014;
Features
Key Location Qualifier Value
STS 1..82 standard_namePCR 82 bp amplicon
noteevent-specific RT-PCR
target3'integration border region (IBR) between the insert of maize event Bt176 and the maize host genome
primer_b 1..18 standard_namePrimer forward: Bt176 F
noteGGCCGTGAACGAGCTGTT
targetinsert
primer_b 26..47 standard_nameRT-PCR probe: Bt176 Probe
noteFAM-AGCAACCAGATCGGCCGACACC-TAMRA
primer_b complement(58..82) standard_namePrimer reverse: Bt176 R
noteGGGAAGAAGCCTACATGTTTTCTAA
target3'-host genome
Sequence information
Length: 82 BP, A Count: 21, C Count: 26, T Count: 17, G Count: 18
ggccgtgaac gagctgttnn nnnnnagcaa ccagatcggc cgacaccnnn nnnnnnntta        60
gaaaacatgt aggcttcttc cc                                                 82