| Entry information |
|---|
| Entry name | QT-EVE-ZM-013; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
| GMO Unique Identifier | SYN-IR604-5 |
| Description |
|---|
| Description | Quantitative PCR method for detection of maize event MIR604 (Mazzara et al., 2007). |
| Keywords | event_specific. |
| From | Zea mays (maize) - event MIR604 (SYN-IR604-5) |
| References |
|---|
| 1 | Mazzara M., Munaro B., Foti N., Savini C., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line MIR604 Using Real-time PCR - Validation Report and Protocol - Maize Seeds Sampling and DNA Extraction" Online Publication (2007)
|
| 2 | "PCR reactions set up and amplification conditions" Online Publication (2010)
|
| Cross-references |
|---|
| GMOMETHODS | QT-TAX-ZM-014; |
| Features |
|---|
| Key | Location | Qualifier | Value |
|---|
| STS | 1..76 | standard_name | PCR 76 bp amplicon | | note | event-specific RT-PCR | | target | 5' integration border region (IBR) between the insert of maize event MIR 604 and the maize host genome | | primer_b | 1..18 | standard_name | Primer forward: MIR604 primer F | | note | GCGCACGCAATTCAACAG | | target | 5'-host genome | | primer_b | 20..45 | standard_name | RT-PCR probe: MIR604 Probe | | note | FAM-AGGCGGGAAACGACAATCTGATCATG-TAMRA | | primer_b | complement(51..76) | standard_name | Primer reverse: MIR604 primer R | | note | GGTCATAACGTGACTCCCTTAATTCT | | target | insert |
|
| Sequence information |
|---|
| Length: 76 BP, A Count: 24, C Count: 15, T Count: 12, G Count: 19 |
gcgcacgcaa ttcaacagna ggcgggaaac gacaatctga tcatgnnnnn agaattaagg 60
gagtcacgtt atgacc 76
|
