Only one hit for query 'ac:MON-00531-6'
ID QT-EVE-GH-004; SV 0; linear; genomic DNA; STS; SYN; 72 BP. XX AC MON-00531-6; XX DT 18-NOV-2005 DT 03-NOV-2010 XX DE Quantitative PCR method for detection of cotton event MON531 DE (Mazzara et al., 2008). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event MON531 (MON-00531-6) XX RN [1] RP 1-72 RA Mazzara M., Bogni A., Foti N., Van Den Eede G.; RT "Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/43936 XX RN [2] RP 1-72 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-GH-004.pdf XX DR GMOMETHODS; QT-TAX-GH-015; XX FH Key Location/Qualifiers FH FT STS 1..72 FT /standard_name="PCR 72 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of cotton event MON531 and the cotton host genome" FT primer_bind 1..20 FT /standard_name="Primer forward: 531-F" FT /note="AACCAATGCCACCCCACTGA" FT /target="5'-host genome" FT primer_bind complement(32..51) FT /standard_name="RT-PCR probe: 531-P" FT /note="FAM-TTGTCCCTCCACTTCTTCTC-TAMRA" FT primer_bind complement(52..72) FT /standard_name="Primer reverse: 531-R" FT /note="TCCCATTCGAGTTTCTCACGT" FT /target="insert" XX SQ Sequence 72 BP; 24 A; 13 C; 18 G; 6 T; 11 other; aaccaatgcc accccactga nnnnnnnnnn ngagaagaag tggagggaca aacgtgagaa 60 actcgaatgg ga 72 //