ID QT-EVE-ZM-036; SV 0; linear; genomic DNA; STD; SYN; 85 BP. XX AC MON-95275-7; XX DT 14-FEB-2024 DT 14-FEB-2024 XX DE Quantitative PCR method for detection of maize event MON 95275 (EURL DE GMFF, 2023). XX KW event_specific. XX OS Zea mays (maize) - event MON 95275 (MON-95275-7) XX RN [1] RP 1-85 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), RT Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 95275 Using Real-time PCR - RT Validation Report"; RL Online Publication (2023). RX EURL_GMFF=EURL-VL-01-22-VR.pdf RX EURL_GMFF=EURL-VL-01-22-VM.pdf XX RN [2] RP 1-85 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2023). RX PCR=QT-EVE-ZM-036.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..85 FT /standard_name="PCR 85 bp amplicon" FT /note="Event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event MON 95275 and the maize host genome" FT primer_bind 1..22 FT /standard_name="Primer forward: MON 95275 primer 1" FT /note="GCGCATGAAGTTTCAGGTCTGT" FT /target="5'-host genome" FT primer_bind 25..46 FT /standard_name="RT-PCR probe: MON 95275 probe" FT /note="FAM-CAGCCGGCCCGATCAAACACTG-TAMRA" FT primer_bind complement(60..85) FT /standard_name="Primer reverse: MON 95275 primer 2" FT /note="GTCGCTACCTTAGGACCGTTATAGTT" FT /target="insert" XX SQ Sequence 85 BP; 22 A; 22 C; 22 G; 19 T; 0 other; gcgcatgaag tttcaggtct gtnncagccg gcccgatcaa acactgnnnn nnnnnnnnna 60 actataacgg tcctaaggta gcgac 85 //