ID QL-TAX-OS-003; SV 0; linear; genomic DNA; STS; PLN; 68 BP. XX AC ; XX DT 04-AUG-2009 DT 26-FEB-2016 XX DE Qualitative PCR method for detection of rice root-specific GOS9 gene XX KW taxon_specific, validated_in_combination. XX OS Oryza sativa (rice) XX RN [1] RP 1-68 RA Grohmann L., Maede D.; RT "Detection of genetically modified rice: collaborative validation study RT of a construct-specific real-time PCR method for detection of transgenic RT Bt rice"; RL Eur. Food Res. Technol. 228:497-500 (2009). RX DOI=10.1007/s00217-008-0964-1 XX RN [2] RP 1-68 RA Savini C., Querci M., Ermolli M., Mazzara M., Cordeil S., Van den Eede RA G.; RT "Report on the Verification of the Performance of a Method for the RT Detection of 'Bt63' Rice Using Real-Time PCR"; RL Online Publication (2008). RX EURL_GMFF=Bt63_Rice_verification_report_final.pdf XX RN [3] RP 1-68 RA Grohmann L., Reiting R., Maede D., Uhlig S., Simon K., Frost K., RA Jit Randhawa G., Zur K.; RT "Collaborative trial validation of cry1Ab/Ac and Pubi-cry TaqMan-based real-time PCR assays for detection of DNA derived from genetically modified Bt plant products"; RL Accred Qual Assur 20:85-96 (2015). RX DOI=10.1007/s00769-015-1108-5 XX RN [4] RP 1-68 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QL-CON-00-007; DR GMOMETHODS; QL-CON-00-009; DR GMOMETHODS; QL-CON-00-013; XX FH Key Location/Qualifiers FH FT STS 1..68 FT /standard_name="PCR 68 bp amplicon" FT /note="Taxon-specific RT-PCR for rice" FT /target="rice root-specific GOS9 gene" FT primer_bind 1..18 FT /standard_name="Primer forward: org1" FT /note="TTAGCCTCCCGCTGCAGA" FT /target="GOS9" FT primer_bind 20..43 FT /standard_name="RT-PCR probe: orgp" FT /note="FAM-CGGCAGTGTGGTTGGTTTCTTCGG-Dabcyl" FT primer_bind complement(49..68) FT /standard_name="Primer reverse: org2" FT /note="AGAGTCCACAAGTGCTCCCG" FT /target="GOS9" XX SQ Sequence 68 BP; 8 A; 18 C; 24 G; 18 T; 0 other; ttagcctccc gctgcaganc ggcagtgtgg ttggtttctt cggnnnnncg ggagcacttg 60 tggactct 68 //