ID QT-EVE-ZM-021; SV 0; linear; genomic DNA; STS; SYN; 80 BP. XX AC DP-098140-6; XX DT 16-APR-2008 DT 26-AGO-2011 XX DE Quantitative PCR method for detection of maize event 98140 (Savini et al., 2011) XX KW event_specific. XX OS Zea mays (maize) - event 98140 (DP-098140-6) XX RN [1] RP 1-80 RA Savini C., ; RT "Event-specific Method for the Quantification of Maize 98140 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX EURL_GMFF=DP-098140-6_validated_Method.pdf RX EURL_GMFF=DP-098140-6_val_report.pdf XX RN [2] RP 1-80 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2011). RX PCR=QT-EVE-ZM-021.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..80 FT /standard_name="PCR 80 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5'integration border region (IBR) between the insert of maize event 98140 and the maize host genome"; FT primer_bind 1..26 FT /standard_name="Primer forward: DP098-f6" FT /note="GTGTGTATGTCTCTTTGCTTGGTCTT" FT /target="5'-host genome" FT primer_bind 28..60 FT /standard_name="RT-PCR probe: DP098-p5" FT /note="FAM-CTCTATCGATCCCCCTCTTTGATAGTTTAAACT-TAMRA" FT primer_bind complement(61..80) FT /standard_name="Primer reverse: DP098-r2" FT /note="GATTGTCGTTTCCCGCCTTC" FT /target="insert" XX SQ Sequence 80 BP; 16 A; 18 C; 17 G; 29 T; 0 other; gtgtgtatgt ctctttgctt ggtcttnctc tatcgatccc cctctttgat agtttaaact 60 gaaggcggga aacgacaatc 80 //