ID QT-EVE-ZM-030; SV 0; linear; genomic DNA; STD; SYN; 116 BP. XX AC MON-87429-9; XX DT 14-APR-2021 DT 27-AGO-2021 XX DE Quantitative PCR method for detection of maize event MON 87429 (EURL GMFF, 2021). XX KW event_specific. XX OS Zea mays (maize) - event MON 87429 (MON-87429-9) XX RN [1] RP 1-116 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 87429 Using Real-time PCR - Validation Report"; RL Online Publication (2021). RX EURL_GMFF=EURL-VL-07-19-VR.pdf RX EURL_GMFF=EURL-VL-07-19-VP.pdf XX RN [2] RP 1-116 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2021). RX PCR=QT-EVE-ZM-030.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..116 FT /standard_name="PCR 116 bp amplicon" FT /note="Event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event MON87429 and the maize host genome" FT primer_bind 1..30 FT /standard_name="Primer forward: MON 87429 primer 1" FT /note="CGAGACAGACTCAATGTATCCGAGATACTC" FT /target="5'-host genome" FT primer_bind complement(56..85) FT /standard_name="RT-PCR probe: MON 87429 probe" FT /note="FAM-TCCCGGACATGAAACCAAACAAGAGTGGTC-TAMRA" FT primer_bind complement(90..116) FT /standard_name="Primer reverse: MON 87429 primer 2" FT /note="CCATCATACTCATTGCTGATCCATGTA" FT /target="insert" XX SQ Sequence 116 BP; 33 A; 22 C; 26 G; 35 T; 0 other; cgagacagac tcaatgtatc cgagatactc nnnnnnnnnn nnnnnnnnnn nnnnngacca 60 ctcttgtttg gtttcatgtc cgggannnnt acatggatca gcaatgagta tgatgg 116 //