ID QT-EVE-ZM-007; SV 0; linear; genomic DNA; STS; SYN; 112 BP. XX AC MON-00021-9; XX DT 26-JAN-2006 DT 14-OCT-2010 XX DE Quantitative PCR method for detection of maize event GA21 DE (Paoletti et al., 2005). XX KW event_specific. XX OS Zea mays (maize) - event GA21 (MON-00021-9) XX RN [1] RP 1-112 RA Paoletti C., Mazzara M., Puumalaainen J., Rasulo D., Van Den Eede G.; RT "Validation of an Event-Specific Method for the Quantitation of Maize Line GA21 Using Real-Time PCR Validation Report and Protocol"; RL Online Publication (2005). RX CRL=GA21_Validation_Report+Protocol[1].pdf XX RN [2] RP 1-112 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-007.pdf XX DR GMOMETHODS; QT-TAX-ZM-011; XX FH Key Location/Qualifiers FH FT STS 1..112 FT /standard_name="PCR 112 bp amplicon (Monsanto)" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event GA21 and the maize host genome" FT primer_bind 1..29 FT /standard_name="Primer forward: GA21 primer F" FT /note="CTTATCGTTATGCTATTTGCAACTTTAGA" FT /target="5'-host genome" FT primer_bind 31..70 FT /standard_name="RT-PCR probe: GA21 Probe PR" FT /note="FAM-CATATACTAACTCATATCTCTTTCTCAACAGCAGGTGGGT- FT TAMRA" FT primer_bind complement(96..112) FT /standard_name="Primer reverse: GA21 primer R" FT /note="TGGCTCGCGATCCTCCT" FT /target="insert" XX SQ Sequence 112 BP; 23 A; 19 C; 17 G; 27 T; 26 other; cttatcgtta tgctatttgc aactttagan catatactaa ctcatatctc tttctcaaca 60 gcaggtgggt nnnnnnnnnn nnnnnnnnnn nnnnnaggag gatcgcgagc ca 112 //