ID QT-EVE-ZM-019; SV 0; linear; genomic DNA; STS; SYN; 95 BP. XX AC SYN-E3272-5; XX DT 25-AUG-2009 DT 05-FEB-2015 XX DE Quantitative PCR method for detection of maize event 3272 DE (Charles Delobel et al., 2008). XX KW event_specific. XX OS Zea mays (maize) - event 3272 (SYN-E3272-5) XX RN [1] RP 1-95 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize Event 3272 Using Real-time PCR - Validation Report and Validated Method. Corrected version 1."; RL Online Publication (2014). RX EURL_GMFF=CRL-VL-03-06-VR-Corrected-Version-1.pdf XX RN [2] RP 1-95 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-019.pdf XX DR GMOMETHODS; QT-TAX-ZM-014; XX FH Key Location/Qualifiers FH FT STS 1..95 FT /standard_name="PCR 95 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event 3272 and the maize host genome" FT primer_bind 1..26 FT /standard_name="Primer forward: ES3272-F" FT /note="TCATCAGACCAGATTCTCTTTTATGG" FT /target="5'-host genome" FT primer_bind 47..69 FT /standard_name="RT-PCR probe: ES3272-P" FT /note="FAM-ACTGCTGACGCGGCCAAACACTG-TAMRA" FT primer_bind complement(76..95) FT /standard_name="Primer reverse: ES3272-R" FT /note="CGTTTCCCGCCTTCAGTTTA" FT /target="insert" XX SQ Sequence 95 BP; 20 A; 17 C; 17 G; 15 T; 26 other; tcatcagacc agattctctt ttatggnnnn nnnnnnnnnn nnnnnnactg ctgacgcggc 60 caaacactgn nnnnntaaac tgaaggcggg aaacg 95 //