ID QL-ELE-00-008; SV 1; linear; genomic DNA; STD; BCT; 94 BP. XX AC ; XX DT 26-DEC-2012 DT 13-JUN-2017 XX DE Qualitative PCR method for detection of nopaline synthase promoter (P-nos). XX KW element_specific. XX RN [1] RP 1-94 RT "Detection of the P-nos sequence to screen for components of genetically modified organisms (GMOs) in foodstuffs using real-time PCR"; RL BVL L 00.00-141:2013-01 (2013). RX BVL=bvl-l-0000-141/179718826 XX RN [2] RP 1-94 RT "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products -- Part 4: Real-time PCR based screening methods for the detection of the P-nos and P-nos-nptII DNA sequences"; RL ISO/TS 21569-4:2016 (2016). RX ISO=69339 XX RN [3] RP 1-94 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2014). RX PCR=QL-ELE-00-008.pdf XX FH Key Location/Qualifiers FH FT STS 1..94 FT /standard_name="PCR 94 bp amplicon" FT /note="element-specific RT-PCR" FT /target="Nopaline synthase promoter (P-nos) from Agrobacterium tumefaciens" FT primer_bind 1..24 FT /standard_name="Primer reverse: p-nos-R" FT /note="TCAGTGGAGCATTTTTGACAAGAA" FT /target="P-nos" FT primer_bind complement(42..67) FT /standard_name="RT-PCR probe: p-nos-Tm" FT /note="FAM-CGCGTTCAAAAGTCGCCTAAGGTCAC-BBQ" FT primer_bind complement(69..94) FT /standard_name="Primer forward: p-nos-F1" FT /note="AAGCACATACGTCAGAAACCATTATT FT /target="P-nos" XX SQ Sequence 94 BP; 24 A; 15 C; 23 G; 32 T; 0 other; tcagtggagc atttttgaca agaannnnnn nnnnnnnnnn ngtgacctta ggcgactttt 60 gaacgcgnaa taatggtttc tgacgtatgt gctt 94 //