Only one hit for query 'ac%3ASYN-IR162-4'
ID QT-EVE-ZM-022; SV 0; linear; genomic DNA; STS; SYN; 92 BP. XX AC SYN-IR162-4; XX DT 21-JAN-2009 DT 5-FEB-2015 XX DE Quantitative PCR method for detection of maize event MIR162 (Charles Delobel et al., 2011) XX KW event_specific. XX OS Zea mays (maize) - event MIR162 (SYN-IR162-4) XX RN [1] RP 1-92 RA Charles Delobel C., Mazzara M., Bevilacqua A., Van den Eede G.; RT "Event-specific Method for the Quantification of Maize MIR162 by Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX DOI=10.2788/44161 XX RN [2] RP 1-92 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2011). RX PCR=QT-EVE-ZM-022.pdf XX DR GMOMETHODS; QT-TAX-ZM-014; XX FH Key Location/Qualifiers FH FT STS 1..92 FT /standard_name="PCR 92 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of maize event MIR162 and the maize host genome"; FT primer_bind 1..24 FT /standard_name="Primer forward: MIR162-f1" FT /note="GCGCGGTGTCATCTATGTTACTAG" FT /target="insert" FT primer_bind 34..67 FT /standard_name="RT-PCR probe: MIR162-p1" FT /note="FAM-TCTAGACAATTCAGTACATTAAAAACGTCCGCCA- FT TAMRA" FT primer_bind complement(71..92) FT /standard_name="Primer reverse: MIR162-r1" FT /note="TGCCTTATCTGTTGCCTTCAGA" FT /target="3'-host genome" XX SQ Sequence 92 BP; 27 A; 22 C; 22 G; 21 T; 0 other; gcgcggtgtc atctatgtta ctagnnnnnn nnntctagac aattcagtac attaaaaacg 60 tccgccannn tctgaaggca acagataagg ca 92 //