European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:SYN-E3272-5'
Entry information
Entry name QT-EVE-ZM-019;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-E3272-5
Description
Description Quantitative PCR method for detection of maize event 3272 (Charles Delobel et al., 2008).
Keywords event_specific.
From Zea mays (maize) - event 3272 (SYN-E3272-5)
References
1 Charles Delobel C., Foti N., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Event 3272 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/43051
Reference Position 1-95
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-019.pdf
Reference Position 1-95
Cross-references
GMOMETHODS QT-TAX-ZM-014;
Features
Key Location Qualifier Value
STS 1..95 standard_namePCR 95 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event 3272 and the maize host genome
primer_b 1..26 standard_namePrimer forward: ES3272-F
noteTCATCAGACCAGATTCTCTTTTATGG
target5'-host genome
primer_b 47..69 standard_nameRT-PCR probe: ES3272-P
noteFAM-ACTGCTGACGCGGCCAAACACTG-TAMRA
primer_b complement(76..95) standard_namePrimer reverse: ES3272-R
noteCGTTTCCCGCCTTCAGTTTA
targetinsert
Sequence information
Length: 95 BP, A Count: 20, C Count: 17, T Count: 15, G Count: 17
tcatcagacc agattctctt ttatggnnnn nnnnnnnnnn nnnnnnactg ctgacgcggc        60
caaacactgn nnnnntaaac tgaaggcggg aaacg                                   95