European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-89034-3'
Entry information
Entry name QT-EVE-ZM-018;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-89034-3
Description
Description Quantitative PCR method for detection of maize event MON89034 (Savini et al., 2008).
Keywords event_specific.
From Zea mays (maize) - event MON89034 (MON-89034-3)
References
1 Savini C., Bogni A., Grazioli E., Munaro B., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line MON89034 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/68713
Reference Position 1-77
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-018.pdf
Reference Position 1-77
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..77 standard_namePCR 77 bp_amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of maize event MON89034 and the maize host genome
primer_b 1..27 standard_namePrimer forward: MON89034 primer 1
noteTTCTCCATATTGACCATCATACTCATT
targetinsert
primer_b 30..47 standard_nameRT-PCR probe: MON89034 probe
noteFAM-ATCCCCGGAAATTATGTT-MGBNFQ
primer_b complement(50..77) standard_namePrimer reverse: MON89034 primer 2
noteCGGTATCTATAATACCGTGGTTTTTAAA
target3'-host genome
Sequence information
Length: 77 BP, A Count: 23, C Count: 17, T Count: 25, G Count: 8
ttctccatat tgaccatcat actcattnna tccccggaaa ttatgttnnt ttaaaaacca        60
cggtattata gataccg                                                       77