Only one hit for query 'ac%3aMON-89034-3'
ID QT-EVE-ZM-018; SV 0; linear; genomic DNA; STS; PLN; 77 BP. XX AC MON-89034-3; XX DT 01-APR-2009 DT 17-NOV-2010 XX DE Quantitative PCR method for detection of maize event MON89034 DE (Savini et al., 2008). XX KW event_specific. XX OS Zea mays (maize) - event MON89034 (MON-89034-3) XX RN [1] RP 1-77 RA Savini C., Bogni A., Grazioli E., Munaro B., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Maize Line MON89034 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/68713 XX RN [2] RP 1-77 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-018.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..77 FT /standard_name="PCR 77 bp_amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of maize event MON89034 and the maize host genome" FT primer_bind 1..27 FT /standard_name="Primer forward: MON89034 primer 1" FT /note="TTCTCCATATTGACCATCATACTCATT" FT /target="insert" FT primer_bind 30..47 FT /standard_name="RT-PCR probe: MON89034 probe" FT /note="FAM-ATCCCCGGAAATTATGTT-MGBNFQ" FT primer_bind complement(50..77) FT /standard_name="Primer reverse: MON89034 primer 2" FT /note="CGGTATCTATAATACCGTGGTTTTTAAA" FT /target="3'-host genome" XX SQ Sequence 77 BP; 23 A; 17 C; 8 G; 25 T; 4 other; ttctccatat tgaccatcat actcattnna tccccggaaa ttatgttnnt ttaaaaacca 60 cggtattata gataccg 77 //