ID QT-EVE-ZM-014; SV 0; linear; genomic DNA; STS; SYN; 101 BP. XX AC MON-00021-9; XX DT 17-NOV-2007 DT 23-NOV-2010 XX DE Quantitative PCR method for detection of maize event GA21 DE (Charles Delobel et al., 2007). XX KW event_specific. XX OS Zea mays (maize) - event GA21 (MON-00021-9) XX RN [1] RP 1-101 RA Charles Delobel C., Larcher S., Savini C., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Maize Line GA21 Using Real-time PCR - Validation Report and Protocol - Report on the Verification of Performance of a DNA Extraction Method for Maize Grains"; RL Online Publication (2007). RX DOI=10.2788/62889 XX RN [2] RP 1-101 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-014.pdf XX DR GMOMETHODS; QT-TAX-ZM-014; XX FH Key Location/Qualifiers FH FT STS 1..101 FT /standard_name="PCR 101 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event GA21 and the maize host genome" FT primer_bind 1..27 FT /standard_name="Primer forward: esGA21-5' forward primer" FT /note="CGTTATGCTATTTGCAACTTTAGAACA" FT /target="5'-host genome" FT primer_bind 46..71 FT /standard_name="RT-PCR probe: esGA21-5' probe" FT /note="FAM-TTTCTCAACAGCAGGTGGGTCCGGGT-TAMRA" FT primer_bind complement(85..101) FT /standard_name="Primer reverse: esGA21-5' reverse primer" FT /note="GCGATCCTCCTCGCGTT" FT /target="insert" XX SQ Sequence 101 BP; 17 A; 15 C; 20 G; 18 T; 31 other; cgttatgcta tttgcaactt tagaacannn nnnnnnnnnn nnnnntttct caacagcagg 60 tgggtccggg tnnnnnnnnn nnnnaacgcg aggaggatcg c 101 //