Only one hit for query 'ac:SYN-IR604-5'
ID QT-EVE-ZM-013; SV 0; linear; genomic DNA; STS; SYN; 76 BP. XX AC SYN-IR604-5; XX DT 29-MAY-2006 DT 20-OCT-2010 XX DE Quantitative PCR method for detection of maize event MIR604 DE (Mazzara et al., 2007). XX KW event_specific. XX OS Zea mays (maize) - event MIR604 (SYN-IR604-5) XX RN [1] RP 1-76 RA Mazzara M., Munaro B., Foti N., Savini C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Maize Line MIR604 Using Real-time PCR - Validation Report and Protocol - Maize Seeds Sampling and DNA Extraction"; RL Online Publication (2007). RX DOI=10.2788/30596 XX RN [2] RP 1-76 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-013.pdf XX DR GMOMETHODS; QT-TAX-ZM-014; XX FH Key Location/Qualifiers FH FT STS 1..76 FT /standard_name="PCR 76 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event MIR 604 and the maize host genome" FT primer_bind 1..18 FT /standard_name="Primer forward: MIR604 primer F" FT /note="GCGCACGCAATTCAACAG" FT /target="5'-host genome" FT primer_bind 20..45 FT /standard_name="RT-PCR probe: MIR604 Probe" FT /note="FAM-AGGCGGGAAACGACAATCTGATCATG-TAMRA" FT primer_bind complement(51..76) FT /standard_name="Primer reverse: MIR604 primer R" FT /note="GGTCATAACGTGACTCCCTTAATTCT" FT /target="insert" XX SQ Sequence 76 BP; 24 A; 15 C; 19 G; 12 T; 6 other; gcgcacgcaa ttcaacagna ggcgggaaac gacaatctga tcatgnnnnn agaattaagg 60 gagtcacgtt atgacc 76 //