European Commission > JRC > IHCP > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:SYN-IR604-5'
Entry information
Entry name QT-EVE-ZM-013;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-IR604-5
Description
Description Quantitative PCR method for detection of maize event MIR604 (Mazzara et al., 2007).
Keywords event_specific.
From Zea mays (maize) - event MIR604 (SYN-IR604-5)
References
1 Mazzara M., Munaro B., Foti N., Savini C., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line MIR604 Using Real-time PCR - Validation Report and Protocol - Maize Seeds Sampling and DNA Extraction" Online Publication (2007)
DOI 10.2788/30596
Reference Position 1-76
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-013.pdf
Reference Position 1-76
Cross-references
GMOMETHODS QT-TAX-ZM-014;
Features
Key Location Qualifier Value
STS 1..76 standard_namePCR 76 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event MIR 604 and the maize host genome
primer_b 1..18 standard_namePrimer forward: MIR604 primer F
noteGCGCACGCAATTCAACAG
target5'-host genome
primer_b 20..45 standard_nameRT-PCR probe: MIR604 Probe
noteFAM-AGGCGGGAAACGACAATCTGATCATG-TAMRA
primer_b complement(51..76) standard_namePrimer reverse: MIR604 primer R
noteGGTCATAACGTGACTCCCTTAATTCT
targetinsert
Sequence information
Length: 76 BP, A Count: 24, C Count: 15, T Count: 12, G Count: 19
gcgcacgcaa ttcaacagna ggcgggaaac gacaatctga tcatgnnnnn agaattaagg        60
gagtcacgtt atgacc                                                        76