Only one hit for query 'ac%3ADAS-59122-7'
ID QT-EVE-ZM-012; SV 0; linear; genomic DNA; STS; SYN; 86 BP. XX AC DAS-59122-7; XX DT 12-JAN-2006 DT 13-OCT-2010 XX DE Quantitative PCR method for detection of maize event 59122 DE (Mazzara et al., 2006). XX KW event_specific. XX OS Zea mays (maize) - event 59122 (DAS-59122-7) XX RN [1] RP 1-86 RA Mazzara M., Grazioli E., Larcher S., Savini C., Van Den Eede G.; RT "Event-Specific Method for the Quantitation of Maize Line DAS-59122-7 Using Real-Time PCR - Validation Report and Protocol"; RL Online Publication (2006). RX DOI=10.2788/31820 XX RN [2] RP 1-86 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-012.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..86 FT /standard_name="PCR 86 bp amplicon" FT /note="event-specific RT-PCR" FT /target="Integration border region (IBR) between the insert of maize event 59122 and the maize host genome" FT primer_bind 1..23 FT /standard_name="Primer forward: DAS-59122-7-rb1f" FT /note="GGGATAAGCAAGTAAAAGCGCTC" FT /target="not specified" FT primer_bind 36..61 FT /standard_name="RT-PCR probe: DAS-59122-7-rb1s" FT /note="FAM-TTTAAACTGAAGGCGGGAAACGACAA-TAMRA" FT primer_bind complement(63..86) FT /standard_name="Primer reverse: DAS-59122-rb1r" FT /note="CCTTAATTCTCCGCTCATGATCAG" FT /target="not specified" XX SQ Sequence 86 BP; 28 A; 11 C; 22 G; 12 T; 13 other; gggataagca agtaaaagcg ctcnnnnnnn nnnnntttaa actgaaggcg ggaaacgaca 60 anctgatcat gagcggagaa ttaagg 86 //