European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-00863-5'
Entry information
Entry name QT-EVE-ZM-009;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-00863-5
Description
Description Quantitative PCR method for detection of maize event MON863 (Mazzara et al., 2005).
Keywords event_specific.
From Zea mays (maize) - event MON863 (MON-00863-5)
References
1 Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line MON 863 Using Real-Time PCR - Validation Report and Protocol" Online Publication (2005)
BSHOP LBNA21830
Reference Position 1-84
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-009.pdf
Reference Position 1-84
Cross-references
GMOMETHODS QT-TAX-ZM-011;
Features
Key Location Qualifier Value
STS 1..84 standard_namePCR 84 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event MON 863 and the maize host genome
primer_b 1..23 standard_namePrimer forward: MON863 primer F
noteTGTTACGGCCTAAATGCTGAACT
target5'-host genome
primer_b complement(26..53) standard_nameRT-PCR probe: MON863 Probe
noteFAM-TGAACACCCATCCGAACAAGTAGGGTCA-TAMRA
primer_b complement(63..84) standard_namePrimer reverse: MON863 primer R
noteGTAGGATCGGAAAGCTTGGTAC
targetinsert
Sequence information
Length: 84 BP, A Count: 15, C Count: 19, T Count: 23, G Count: 16
tgttacggcc taaatgctga actnntgacc ctacttgttc ggatgggtgt tcannnnnnn        60
nngtaccaag ctttccgatc ctac                                               84