Only one hit for query 'ac%3AMON-00863-5'
ID QT-EVE-ZM-009; SV 0; linear; genomic DNA; STS; SYN; 84 BP. XX AC MON-00863-5; XX DT 19-FEB-2010 DT 03-NOV-2010 XX DE Quantitative PCR method for detection of maize event MON863 DE (Mazzara et al., 2005). XX KW event_specific. XX OS Zea mays (maize) - event MON863 (MON-00863-5) XX RN [1] RP 1-84 RA Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.; RT "Event-Specific Method for the Quantitation of Maize Line MON 863 Using Real-Time PCR - Validation Report and Protocol"; RL Online Publication (2005). RX BSHOP=LBNA21830 XX RN [2] RP 1-84 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-009.pdf XX DR GMOMETHODS; QT-TAX-ZM-011; XX FH Key Location/Qualifiers FH FT STS 1..84 FT /standard_name="PCR 84 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event MON 863 and the maize host genome" FT primer_bind 1..23 FT /standard_name="Primer forward: MON863 primer F" FT /note="TGTTACGGCCTAAATGCTGAACT" FT /target="5'-host genome" FT primer_bind complement(26..53) FT /standard_name="RT-PCR probe: MON863 Probe" FT /note="FAM-TGAACACCCATCCGAACAAGTAGGGTCA-TAMRA" FT primer_bind complement(63..84) FT /standard_name="Primer reverse: MON863 primer R" FT /note="GTAGGATCGGAAAGCTTGGTAC" FT /target="insert" XX SQ Sequence 84 BP; 15 A; 19 C; 16 G; 23 T; 11 other; tgttacggcc taaatgctga actnntgacc ctacttgttc ggatgggtgt tcannnnnnn 60 nngtaccaag ctttccgatc ctac 84 //