European Commission > JRC > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-00603-6'
Entry information
Entry name QT-EVE-ZM-008;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-00603-6
Description
Description Quantitative PCR method for detection of maize event NK603 (Mazzara et al., 2005).
Keywords event_specific.
From Zea mays (maize) - Event NK603 (MON-00603-6)
References
1 Mazzara M., Paoletti C., Puumalaainen J., Rasulo D., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line NK603 Using Real-Time PCR - Validation Report and Protocol" Online Publication (2005)
BSHOP LBNA21825
Reference Position 1-108
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-008.pdf
Reference Position 1-108
Cross-references
GMOMETHODS QT-TAX-ZM-011;
Features
Key Location Qualifier Value
STS 1..108 standard_name108 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of maize event NK 603 and the maize host genome
primer_b 1..27 standard_namePrimer forward: NK603-F
noteATGAATGACCTCGAGTAAGCTTGTTAA
targetinsert
primer_b 54..79 standard_nameRT-PCR probe: NK603-PR
noteFAM-TGGTACCACGCGACACACTTCCACTC-TAMRA
primer_b complement(81..108) standard_namePrimer reverse: NK603-R
noteAAGAGATAACAGGATCCACTCAAACACT
target3'-host genome
Sequence information
Length: 108 BP, A Count: 19, C Count: 19, T Count: 26, G Count: 17
atgaatgacc tcgagtaagc ttgttaannn nnnnnnnnnn nnnnnnnnnn nnntggtacc        60
acgcgacaca cttccactcn agtgtttgag tggatcctgt tatctctt                    108