European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:DAS-40278-9'
Entry information
Entry name QT-EVE-ZM-004;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier DAS-40278-9
Description
Description Quantitative PCR method for detection of maize event DAS-40278-9 (Savini et al., 2012).
Keywords event_specific.
From Zea mays (maize) - event DAS-40278-9 (DAS-40278-9)
References
1 Savini C., Bogni A., Foti N., Mazzara M., Kreysa J.; "Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7" Online Publication (2012)
DOI 10.2788/64013
Reference Position 1-98
2 "PCR reactions set up and amplification conditions" Online Publication (2012)
PCR QT-EVE-ZM-004.pdf
Reference Position 1-98
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..98 standard_namePCR 98 bp amplicon
noteevent-specific RT-PCR
target5'integration border region (IBR) between the insert of maize event DAS-40278-9 and the maize host genome
primer_b 1..22 standard_namePrimer forward: DAS-40278-9_5'-f1
noteCACGAACCATTGAGTTACAATC
target5'-host genome
primer_b complement(43..67) standard_nameRT-PCR probe: DAS-40278-9_5'-S2
noteFAM-CGTAGCTAACCTTCATTGTATTCCG-TAMRA
primer_b complement(76..98) standard_namePrimer reverse: DAS-40278-9_5'-r3
noteTGGTTCATTGTATTCTGGCTTTG
targetinsert
Sequence information
Length: 98 BP, A Count: 39, C Count: 23, T Count: 18, G Count: 18
cacgaaccat tgagttacaa tcnnnnnnnn nnnnnnnnnn nncggaatac aatgaaggtt        60
agctacgnnn nnnnncaaag ccagaataca atgaacca                                98