European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-87427-7'
Entry information
Entry name QT-EVE-ZM-003;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87427-7
Description
Description Quantitative PCR method for detection of maize event MON87427(EURL GMFF, 2015).
Keywords event_specific.
From Zea mays (maize) - event MON87427 (MON-87427-7)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON 87427 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2015)
EURL_GMFF EURL-VL-03-12-VR.pdf
EURL_GMFF EURL-VL-03-12-VM.pdf
Reference Position 1-95
2 "PCR reactions set up and amplification conditions" Online Publication (2015)
PCR QT-EVE-ZM-003.pdf
Reference Position 1-95
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..95 standard_namePCR 95 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event MON87427 and the maize host genome
primer_b 1..22 standard_namePrimer forward: MON 87427 primer 1
noteACGGAAACGGTCGGGTCAAATG
target5'-host genome
primer_b 30..57 standard_nameRT-PCR probe: MON 87427 probe
noteFAM-TCGGGACAATATGGAGAAAAAGAAAGAG- TAMRA
misc_rec 33..64 noteFragment of genomic DNA recombined during insertion, possibly from Chr. 5
primer_b complement(72..95) standard_namePrimer reverse: MON 87427 primer 2
noteCCATGTAGATTTCCCGGTTTTCTC
targetinsert
Sequence information
Length: 95 BP, A Count: 42, C Count: 12, T Count: 15, G Count: 26
acggaaacgg tcgggtcaaa tgnnnnnnnt cgggacaata tggagaaaaa gaaagagnnn        60
nnnnnnnnnn ngagaaaacc gggaaatcta catgg                                   95