European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'id:QT-eve-ST*'
Entry information
Entry name QT-EVE-ST-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier BPS-25271-9
Description
Description Quantitative PCR method for detection of potato event EH92-527-1 (Savini et al., 2006).
Keywords event_specific.
From Solanum tuberosum (potato) - event EH92-527-1 (BPS-25271-9)
References
1 Savini C., Foti N., Mazzara M., Charles Delobel C., Van Den Eede G.; "Event-specific Method for the Quantification of Event EH92-527-1 Potato Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Potato" Online Publication (2006)
DOI 10.2788/30418
Reference Position 1-134
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ST-001.pdf
Reference Position 1-134
Cross-references
GMOMETHODS QT-TAX-ST-010;
Features
Key Location Qualifier Value
STS 1..134 standard_namePCR 134 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of potato event EH92-527-1 and the potato host genome
primer_b 1..23 standard_namePrimer forward: Event527-bf1
noteGTGTCAAAACACAATTTACAGCA
targetinsert
primer_b complement(86..110) standard_nameRT-PCR probe: St527-S2
noteFAM-AGATTGTCGTTTCCCGCCTTCAGTT-TAMRA
primer_b complement(113..134) standard_namePrimer reverse: St527-R1
noteTCCCTTAATTCTCCGCTCATGA
target3'-host genome
Sequence information
Length: 134 BP, A Count: 28, C Count: 12, T Count: 12, G Count: 18
gtgtcaaaac acaatttaca gcannnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnaactg aaggcgggaa acgacaatct nntcatgagc       120
ggagaattaa ggga                                                         134