European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:ACS-GM006-4'
Entry information
Entry name QT-EVE-GM-007;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-GM006-4
Description
Description Quantitative PCR method for detection of soybean event A5547-127 (Charles Delobel et al., 2009).
Keywords event_specific.
From Glycine max (soybean) - event A5547-127 (ACS-GM006-4)
References
1 Charles Delobel C., Bogni A., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Soybean Line A5547-127 Using Real-time PCR - Validation Report and Protocol" Online Publication (2009)
DOI 10.2788/60083
Reference Position 1-75
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GM-007.pdf
Reference Position 1-75
Cross-references
GMOMETHODS QT-TAX-GM-020;
Features
Key Location Qualifier Value
STS 1..75 standard_namePCR 75 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of soybean event A5547-127 and the soybean host genome
primer_b 1..22 standard_namePrimer forward: SHA003
noteGCTATTTGGTGGCATTTTTCCA
target5'-host genome
primer_b 28..53 standard_nameRT-PCR probe: TM058
noteFAM-CCGCAATGTCATACCGTCATCGTTGT-TAMRA
primer_b complement(55..75) standard_namePrimer reverse: SHA004
noteCACTGCGGCCAACTTACTTCT
targetinsert
Sequence information
Length: 75 BP, A Count: 14, C Count: 15, T Count: 22, G Count: 18
gctatttggt ggcatttttc cannnnnccg caatgtcata ccgtcatcgt tgtnagaagt        60
aagttggccg cagtg                                                         75