European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-89788-1'
Entry information
Entry name QT-EVE-GM-006;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-89788-1
Description
Description Quantitative PCR method for detection of soybean event MON89788 (Charles Delobel et al., 2013).
Keywords event_specific.
From Glycine max (soybean) - event MON89788 (MON-89788-1)
References
1 Charles Delobel C., Bogni A., Pinski G., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Soybean Line MON 89788 Using Real-time PCR v 1.01 - Validation Report and Validated Method" Online Publication (2013)
DOI 10.2788/20464
Reference Position 1-139
2 "PCR reactions set up and amplification conditions" Online Publication (2013)
PCR QT-EVE-GM-006.pdf
Reference Position 1-139
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..139 standard_namePCR 139 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of soybean event MON 89788 and the soybean host genome
primer_b 1..20 standard_namePrimer forward: MON89788-F
noteTCCCGCTCTAGCGCTTCAAT
target5'-host genome
primer_b 56..79 standard_nameRT-PCR probe: MON89788-P
noteFAM-CTGAAGGCGGGAAACGACAATCTG-TAMRA
primer_b complement(121..139) standard_namePrimer reverse: MON89788-R
noteTCGAGCAGGACCTGCAGAA
targetinsert
Sequence information
Length: 139 BP, A Count: 13, C Count: 19, T Count: 15, G Count: 16
tcccgctcta gcgcttcaat nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnctgaa        60
ggcgggaaac gacaatctgn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
ttctgcaggt cctgctcga                                                    139