European Commission > JRC > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-87769-7'
Entry information
Entry name QT-EVE-GM-002;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87769-7
Description
Description Quantitative PCR method for detection of soybean event MON87769 (Mazzara et al., 2012)
Keywords event_specific.
From Glycine max (soybean) - event MON87769 (MON-87769-7)
References
1 Mazzara M., Charles Delobel C., Pinski G., Savini C., Van den Eede G.; "Event-specific Method for the Quantification of Soybean MON87769 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2012)
DOI 10.2788/4544
Reference Position 1-87
2 "PCR reactions set up and amplification conditions" Online Publication (2012)
PCR QT-EVE-GM-002.pdf
Reference Position 1-87
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..87 standard_namePCR 87 bp amplicon
noteEvent-specific RT-PCR
target3'integration border region (IBR) between the insert of soybean event MON87769 and the soybean host genome
primer_b 1..27 standard_namePrimer forward: MON 87769 primer 1
noteCATACTCATTGCTGATCCATGTAGATT
targetinsert
primer_b 29..56 standard_nameRT-PCR probe: MON 87769 probe
noteFAM-CCCGGACATGAAGCCATTTACAATTGAC-TAMRA
primer_b complement(66..87) standard_namePrimer reverse: MON 87769 primer 2
noteGCAAGTTGCTCGTGAAGTTTTG
target3'-host genome
Sequence information
Length: 87 BP, A Count: 27, C Count: 24, T Count: 24, G Count: 12
catactcatt gctgatccat gtagattncc cggacatgaa gccatttaca attgacnnnn        60
nnnnncaaaa cttcacgagc aacttgc                                            87