European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MST-FG072-2'
Entry information
Entry name QT-EVE-GM-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MST-FG072-2
Description
Description Quantitative PCR method for detection of soybean event FG72 (Savini et al., 2012)
Keywords event_specific.
From Glycine max (soybean) - event FG72 (MST-FG072-2)
References
1 Savini C.,; "Event-specific Method for the Quantification of Soybean FG72 Using Real-time PCR - Validation Report and Protocol" Online Publication (2012)
EURL_GMFF EURL-VL-04 10 VR.pdf
EURL_GMFF EURL-VL-04-10 VP.pdf
Reference Position 1-70
2 "PCR reactions set up and amplification conditions" Online Publication (2012)
PCR QT-EVE-GM-001.pdf
Reference Position 1-70
Cross-references
GMOMETHODS QT-TAX-GM-020;
Features
Key Location Qualifier Value
STS 1..70 standard_namePCR 70 bp amplicon
noteevent-specific RT-PCR
target3'integration border region (IBR) between the insert of soybean event FG72 and the soybean host genome
primer_b 1..20 standard_namePrimer forward: MAE071
noteAGATTTGATCGGGCTGCAGG
targetinsert
primer_b 25..43 standard_nameRT-PCR probe: TM325
noteFAM-AATGTGGTTCATCCGTCTT-MGBNFQ
primer_b complement(49..70) standard_namePrimer reverse: SHA097
noteGCACGTATTGATGACCGCATTA
target3'-host genome
Sequence information
Length: 70 BP, A Count: 15, C Count: 12, T Count: 25, G Count: 18
agatttgatc gggctgcagg nnnnaatgtg gttcatccgt cttnnnnnta atgcggtcat        60
caatacgtgc                                                               70