European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-88913-8'
Entry information
Entry name QT-EVE-GH-007;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-88913-8
Description
Description Quantitative PCR method for detection of cotton event MON88913 (Charles Delobel et al., 2009).
Keywords event_specific.
From Gossypium hirsutum (upland cotton) - event MON88913 (MON-88913-8)
References
1 Charles Delobel C., Luque Perez E., Pinski G., Bogni A., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Cotton MON 88913 Using Real-time PCR - Validation Report and Protocol" Online Publication (2009)
DOI 10.2788/58818
Reference Position 1-94
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GH-007.pdf
Reference Position 1-94
Cross-references
GMOMETHODS QT-TAX-GH-015;
Features
Key Location Qualifier Value
STS 1..94 standard_namePCR 94 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of cotton event MON 88913 and the cotton host genome
primer_b 1..28 standard_namePrimer forward: MON88913 primer 2
noteCAAATTACCCATTAAGTAGCCAAATTAC
target5'-host genome
primer_b complement(42..63) standard_nameRT-PCR probe: MON88913 probe
noteFAM-AACTATCAGTGTTTGACTACAT-MGBNFQ
primer_b complement(71..94) standard_namePrimer reverse: MON88913 primer 1
noteGGCTTTGGCTACCTTAAGAGAGTC
targetinsert
Sequence information
Length: 94 BP, A Count: 27, C Count: 17, T Count: 19, G Count: 11
caaattaccc attaagtagc caaattacnn nnnnnnnnnn natgtagtca aacactgata        60
gttnnnnnnn gactctctta aggtagccaa agcc                                    94