ID QT-EVE-GH-007; SV 0; linear; genomic DNA; STS; SYN; 94 BP. XX AC MON-88913-8; XX DT 03-APR-2009 DT 15-MAR-2012 XX DE Quantitative PCR method for detection of cotton event MON88913 DE (Charles Delobel et al., 2009). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event MON88913 (MON-88913-8) XX RN [1] RP 1-94 RA Charles Delobel C., Luque Perez E., Pinski G., Bogni A., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Cotton MON 88913 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2009). RX DOI=10.2788/58818 XX RN [2] RP 1-94 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-GH-007.pdf XX DR GMOMETHODS; QT-TAX-GH-015; XX FH Key Location/Qualifiers FH FT STS 1..94 FT /standard_name="PCR 94 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of cotton event MON 88913 and the cotton host genome" FT primer_bind 1..28 FT /standard_name="Primer forward: MON88913 primer 2" FT /note="CAAATTACCCATTAAGTAGCCAAATTAC" FT /target="5'-host genome" FT primer_bind complement(42..63) FT /standard_name="RT-PCR probe: MON88913 probe" FT /note="FAM-AACTATCAGTGTTTGACTACAT-MGBNFQ" FT primer_bind complement(71..94) FT /standard_name="Primer reverse: MON88913 primer 1" FT /note="GGCTTTGGCTACCTTAAGAGAGTC" FT /target="insert" XX SQ Sequence 94 BP; 27 A; 17 C; 11 G; 19 T; 20 other; caaattaccc attaagtagc caaattacnn nnnnnnnnnn natgtagtca aacactgata 60 gttnnnnnnn gactctctta aggtagccaa agcc 94 //