European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-15985-7'
Entry information
Entry name QT-EVE-GH-005;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-15985-7
Description
Description Quantitative PCR method for detection of cotton event MON15985 (Savini et al., 2008).
Keywords event_specific.
From Gossypium hirsutum (upland cotton) - event MON15985 (MON-15985-7)
References
1 Savini C., Mazzara M., Munaro B., Van Den Eede G.; "Event-specific Method for the Quantification of Cotton Line MON 15985 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/4378
Reference Position 1-82
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GH-005.pdf
Reference Position 1-82
Cross-references
GMOMETHODS QT-TAX-GH-015;
Features
Key Location Qualifier Value
STS 1..82 standard_namePCR 82 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of cotton event 15985 and the cotton host genome
primer_b 1..21 standard_namePrimer forward: MON15985 primer 1
noteGTTACTAGATCGGGGATATCC
targetinsert
primer_b 31..60 standard_nameRT-PCR probe: MON15985 Probe
noteFAM-CCGCTCTAGAACTAGTGGATCTGCACTGAA-TAMRA
primer_b complement(62..82) standard_namePrimer reverse: MON15985 primer 2
noteAAGGTTGCTAAATGGATGGGA
target3'-host genome
Sequence information
Length: 82 BP, A Count: 18, C Count: 20, T Count: 20, G Count: 14
gttactagat cggggatatc cnnnnnnnnn ccgctctaga actagtggat ctgcactgaa        60
ntcccatcca tttagcaacc tt                                                 82