European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-00531-6'
Entry information
Entry name QT-EVE-GH-004;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-00531-6
Description
Description Quantitative PCR method for detection of cotton event MON531 (Mazzara et al., 2008).
Keywords event_specific.
From Gossypium hirsutum (upland cotton) - event MON531 (MON-00531-6)
References
1 Mazzara M., Bogni A., Foti N., Van Den Eede G.; "Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/43936
Reference Position 1-72
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GH-004.pdf
Reference Position 1-72
Cross-references
GMOMETHODS QT-TAX-GH-015;
Features
Key Location Qualifier Value
STS 1..72 standard_namePCR 72 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of cotton event MON531 and the cotton host genome
primer_b 1..20 standard_namePrimer forward: 531-F
noteAACCAATGCCACCCCACTGA
target5'-host genome
primer_b complement(32..51) standard_nameRT-PCR probe: 531-P
noteFAM-TTGTCCCTCCACTTCTTCTC-TAMRA
primer_b complement(52..72) standard_namePrimer reverse: 531-R
noteTCCCATTCGAGTTTCTCACGT
targetinsert
Sequence information
Length: 72 BP, A Count: 24, C Count: 13, T Count: 6, G Count: 18
aaccaatgcc accccactga nnnnnnnnnn ngagaagaag tggagggaca aacgtgagaa        60
actcgaatgg ga                                                            72