European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:MON-01445-2'
Entry information
Entry name QT-EVE-GH-003;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-01445-2
Description
Description Quantitative PCR method for detection of cotton event MON1445 (Mazzara et al., 2008).
Keywords event_specific.
From Gossypium hirsutum (upland cotton) - event MON1445 (MON-01445-2)
References
1 Mazzara M., Bogni A., Van Den Eede G.; "Event-specific Method for the Quantification of Cotton Line MON1445 Using Real-time PCR Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/4455
Reference Position 1-87
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GH-003.pdf
Reference Position 1-87
Cross-references
GMOMETHODS QT-TAX-GH-015;
Features
Key Location Qualifier Value
STS 1..87 standard_namePCR 87 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of cotton event MON 1445 and the cotton host genome
primer_b 1..26 standard_namePrimer forward: MON1445 primer forward
noteGGAGTAAGACGATTCAGATCAAACAC
target5'-host genome
primer_b complement(36..64) standard_nameRT-PCR probe: MON1445 probe
noteFAM-ATCAGATTGTCGTTTCCCGCCTTCAGTTT-TAMRA
primer_b complement(68..87) standard_namePrimer reverse: MON1445 primer reverse
noteATCGACCTGCAGCCCAAGCT
targetinsert
Sequence information
Length: 87 BP, A Count: 26, C Count: 14, T Count: 13, G Count: 22
ggagtaagac gattcagatc aaacacnnnn nnnnnaaact gaaggcggga aacgacaatc        60
tgatnnnagc ttgggctgca ggtcgat                                            87