Only one hit for query 'ac%3aMON-01445-2'
ID QT-EVE-GH-003; SV 0; linear; genomic DNA; STS; SYN; 87 BP. XX AC MON-01445-2; XX DT 16-OCT-2006 DT 20-OCT-2010 XX DE Quantitative PCR method for detection of cotton event MON1445 DE (Mazzara et al., 2008). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event MON1445 (MON-01445-2) XX RN [1] RP 1-87 RA Mazzara M., Bogni A., Van Den Eede G.; RT "Event-specific Method for the Quantification of Cotton Line MON1445 Using Real-time PCR Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/4455 XX RN [2] RP 1-87 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-GH-003.pdf XX DR GMOMETHODS; QT-TAX-GH-015; XX FH Key Location/Qualifiers FH FT STS 1..87 FT /standard_name="PCR 87 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of cotton event MON 1445 and the cotton host genome" FT primer_bind 1..26 FT /standard_name="Primer forward: MON1445 primer forward" FT /note="GGAGTAAGACGATTCAGATCAAACAC" FT /target="5'-host genome" FT primer_bind complement(36..64) FT /standard_name="RT-PCR probe: MON1445 probe" FT /note="FAM-ATCAGATTGTCGTTTCCCGCCTTCAGTTT-TAMRA" FT primer_bind complement(68..87) FT /standard_name="Primer reverse: MON1445 primer reverse" FT /note="ATCGACCTGCAGCCCAAGCT" FT /target="insert" XX SQ Sequence 87 BP; 26 A; 14 C; 22 G; 13 T; 12 other; ggagtaagac gattcagatc aaacacnnnn nnnnnaaact gaaggcggga aacgacaatc 60 tgatnnnagc ttgggctgca ggtcgat 87 //